GMMPS is a windows-version program. Under the menu "GMMPS", there are
the following three different sub-minus for run the program on one
sequence once (Single Run), multiple times (Repeatedly Run), 
and run on different sequence sets (Multiple inputs). For each
case, just click the corresponding menu and select the input file.
The input files are built as follows.


1) Single Run

All the input parameters should be specified in a txt file. The following
is an example for the input txt file:

***********************************************
-i
F:\Projects\GMMPS\Data\Example_Seq.txt
-o
F:\Projects\GMMPS\Data\Example_results.txt
-b
F:\Projects\GMMPS\Data\Background_PM.txt
-w
10
-r
0
-n
500
-s
1
*************************************************

In the above file, 
"-i" is the path for input sequence file. The input sequence file should be
fasta format, i.e.

>seq1
AACCGGTTGACCGGTTGAAACCCAAAAAAAGGGTATG
>seq2
GGTAAACCGGCTAGCGATCGATCGACTGACTAGCTAGCATCGACTAGCTAG
>seq3
...

"-o" is the path for the output result file.

"-b" is the parameter file for the 1st order Markov chain. We have an example 
background file: "Background_PM.txt". Without "-b", GMMPS will generate the
background distribution by the input sequence file.

"-W" is the width of the target motif.

"-r" specifies sampling backward strand or not. If 0, only forward strand 
will be sampled. If 1, both strands will be sampled.

"-n" total number of iterations.

"-s" number of pseudo-counts in each position.

You can also specify that each sequence contains exactly one motif site by 
adding a new line ("-e") to the input parameter file.


2) Repeatedly Run

If you want to run GMMPS on one sequence set for multiple times. Add one more
parameter in the input file:
-N
5


3) Multiple inputs

If you want to run GMMPS on several different sequence sets continuously,
build a hyper input file. For example:

******************
2
F:\Projects\GMMPS\Data\GMMPS_inputs_1.txt
F:\Projects\GMMPS\Data\GMMPS_inputs_2.txt
*******************

In the file, the first line specifies how many different sequence sets you
are to run. The following lines are the input files for each sequence set.


We have a simulated sequence sets (Example_Seq.txt) with known motif sites
(Example_Seq.motif.txt) in the package. And an output file for this dataset
is also attached (Example_results.txt).